Review




Structured Review

Coley Pharmaceutical control odn sequence 1982
Control Odn Sequence 1982, supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+odn+sequence+1982/control+odn/pmc01064943-53-27-38
Average 90 stars, based on 1 article reviews
control odn sequence 1982 - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

Sequencing:

Article Title: A Live and Inactivated Chlamydia trachomatis Mouse Pneumonitis Strain Induces the Maturation of Dendritic Cells That Are Phenotypically and Immunologically Distinct
Article Snippet: Hybridoma X63 producing IL-4 was provided by F. Melchers, Basilea Institute, Basel, Switzerland. .. Oligodeoxynucleotide (ODN) sequence 1826 ( 37 ) containing two cytosine phosphate guanosine (CpG) motifs (TCCATGA CG TTCCTGA CG TT; the underlined bases represent the CpG motifs) and control ODN sequence 1982 (TCCAGGACTTCTCTCAGGTT) without CpG motifs were purchased from Coley Pharmaceutical group, Ottawa, Canada. .. LPS was from Sigma, St. Louis, Mo.

Control:

Article Title: A Live and Inactivated Chlamydia trachomatis Mouse Pneumonitis Strain Induces the Maturation of Dendritic Cells That Are Phenotypically and Immunologically Distinct
Article Snippet: Hybridoma X63 producing IL-4 was provided by F. Melchers, Basilea Institute, Basel, Switzerland. .. Oligodeoxynucleotide (ODN) sequence 1826 ( 37 ) containing two cytosine phosphate guanosine (CpG) motifs (TCCATGA CG TTCCTGA CG TT; the underlined bases represent the CpG motifs) and control ODN sequence 1982 (TCCAGGACTTCTCTCAGGTT) without CpG motifs were purchased from Coley Pharmaceutical group, Ottawa, Canada. .. LPS was from Sigma, St. Louis, Mo.



Similar Products

90
Coley Pharmaceutical control odn sequence 1982
Control Odn Sequence 1982, supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+odn+sequence+1982/control+odn/pmc01064943-53-27-38
Average 90 stars, based on 1 article reviews
control odn sequence 1982 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Coley Pharmaceutical control odn sequence 1982 (tccaggacttctctcaggtt)
Control Odn Sequence 1982 (Tccaggacttctctcaggtt), supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+odn+sequence+1982/control+odn/pmc01064943-141-27-38
Average 90 stars, based on 1 article reviews
control odn sequence 1982 (tccaggacttctctcaggtt) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results